During anaphase which of the options occurs
WebOption.A is given as ‘condensation of the chromosomes’. The condensation of chromosomes occurs in the prophase of mitosis. Hence option.A is incorrect. Option.C is given as ‘separation of sister chromatids’. The separation of sister chromatids occurs in anaphase of the mitosis. Hence option.C is incorrect. Option.D is given as ‘spindle … WebOct 4, 2024 · Anaphase starts after the cell passes the spindle formation checkpoint, which allows chromosomes or chromatids to separate. As the microtubules shorten that connect the chromosomes to the centrosomes, …
During anaphase which of the options occurs
Did you know?
WebThe cell cycle has two major phases: interphase and the mitotic phase ( Figure 6.3 ). During interphase, the cell grows and DNA is replicated. During the mitotic phase, the replicated DNA and cytoplasmic contents … WebThe cell goes through 4 steps (prophase, metaphase, anaphase, and telophase.) The cells at the end of the process also have the same amount of chromosomes as the parent cell. At the end, 2 cells are produced. …
WebApr 12, 2024 · Prolonged cell cycle arrests occur naturally in differentiated cells and in response to various stresses such as nutrient deprivation or treatment with chemotherapeutic agents. Whether and how cells survive prolonged cell cycle arrests is not clear. Here, we used S. cerevisiae to compare physiological cell cycle arrests and … WebASK AN EXPERT. Science Biology which of these choices represents one possible corresponding mRNA sequence that can be transcribed by RNA polymerase, and later translated by ribosomes from the following DNA template? 5'- CTGTATCCTAGCACCCAAATCGCAT - 3'; A. 5'- CTA GCA CCC AAA TCG CAT TAG - …
WebMar 20, 2024 · During the synthesis phase of interphase. Explanation: There are two broad sections of the cell cycle, interpase and mitosis. Interphase is divided into G1,S and G2. Mitosis is divided into prophase, metaphase, anaphase, and telophase. G1: "gap one". cell growth. S: "synthesis". DNA replication Weba) It has half the amount of DNA as the parent cell. b) It has half the chromosomes but twice the DNA of the parent cell. c) It has one-fourth the DNA and one-half the chromosomes …
Webanswer choices anaphase I anaphase II metaphase I telophase II Question 5 30 seconds Q. What phase is represented? answer choices metaphase I metaphase II anaphase I anaphase II Question 6 30 seconds Q. When an area of a chromatid is exchanged with the matching area on a chromatid of its homologous chromosome, _________________ …
WebFinal answer. Question 1. All of the following events occur during anaphase EXCEPT A. the separation of sister chromatids B. the shortening of chromosomal microtubules C. shortening of the overlap microtubules D. creation of a sliding force between the overlap microtubules through the microtubule binding proteins E. the movement of daughter ... chu\u0027s express asheboro nc menuWebMitosis takes place in four stages: prophase (sometimes divided into early prophase and prometaphase), metaphase, anaphase, and telophase. You can learn more about these stages in the video on mitosis. In … dfs thanksgivingWebApr 13, 2024 · Pregnancy is an exciting and challenging time for many women. It can be a time of anticipation, joy, and sometimes, a bit of discomfort. From the first signs of pregnancy to the final weeks before delivery, there are many different aspects to consider. In this video, I explore pregnancy through five religions briefly and morning sickness … chu\u0027s eatery menuWebDr. Parag Telang on Instagram: "With the sedentary lifestyle and foul ... dfs the kentWebThe formation of the ovum (mature female gamete) from undifferentiated germ cells is called oogenesis. This process takes place in the ovaries (female gonads). Oogenesis consists of three stages known as the multiplication phase, growth phase, and matura… Article Cell Division arrow_forward chu\u0027s express asheboroWebThe phase of mitosis during which the mitotic spindle begins to form is answer choices prophase. anaphase. interphase. metaphase. Question 12 900 seconds Q. Without crossing over, answer choices meiosis could not produce haploid gametes. only a small number of unique gametes could be produced by a single individual. dfs thanksgiving ownershipWebQuestion: Question 1. All of the following events occur during anaphase EXCEPT A. the separation of sister chromatids B. the shortening of chromosomal microtubules C. … dfs texas